
MacSyFinder Prediction
Acinetobacter baylyi ADP1
![]() |
MoveTo | System id | System | Replicon name | Replicon type | Begin | End | Locus type | Mandatory present | Mandatory missing | Nb of mandatory present | Nb of mandatory missing | Nb of accessory present |
---|---|---|---|---|---|---|---|---|---|---|---|---|
![]() |
T4P_1 | T4P | ACIAD | chromosome | 352513 | 3267446 | multi_loci | T4P_pilT_pilU, T4P_pilP, T4P_pilQ, T4P_pilAE, T4P_pilB, T4P_pilC, T4P_pilI_pilV, T4P_pilN, T4P_pilO, T4P_pilM | _ | 10 | 0 | 1 |
![]() |
T5bSS_1 | T5bSS | ACIAD | chromosome | 921123 | 922922 | single_locus | T5bSS_translocator | _ | 1 | 0 | 0 |
![]() |
T1SS_1 | T1SS | ACIAD | chromosome | 1484367 | 1489107 | single_locus | T1SS_omf, T1SS_mfp, T1SS_abc | _ | 3 | 0 | 0 |
![]() |
T5cSS_1 | T5cSS | ACIAD | chromosome | 1635004 | 1637166 | single_locus | T5cSS_PF03895 | _ | 1 | 0 | 0 |
![]() |
CAS-TypeIF_1 | CAS-TypeIF | ACIAD | chromosome | 2439177 | 2448017 | single_locus | cas1_TypeIF, cas6_TypeIF, cas3-cas2_TypeIF, csy2_TypeIF, csy3_TypeIF | csy1_TypeIF | 5 | 1 | 0 |
![]() |
T6SSi_1 | T6SSi | ACIAD | chromosome | 2635901 | 2656127 | single_locus | T6SSi_evpJ, T6SSi_tssB, T6SSi_tssC, T6SSi_tssD, T6SSi_tssE, T6SSi_tssF, T6SSi_tssG, T6SSi_tssH, T6SSi_tssK, T6SSi_tssL, T6SSi_tssM | T6SSi_tssA, T6SSi_tssI, T6SSi_tssJ | 11 | 3 | 0 |
![]() |
T5bSS_2 | T5bSS | ACIAD | chromosome | 2735297 | 2737063 | single_locus | T5bSS_translocator | _ | 1 | 0 | 0 |
![]() |
MoveTo | Sequence | System id | System | Replicon name | Replicon type | Begin | End | Nb spacers / genes | Consensus repeat / Present gene | Evidence level |
---|---|---|---|---|---|---|---|---|---|---|
![]() |
![]() |
1 | CRISPR | ACIAD | chromosome | 2339338 | 2339725 | 6 | TTTCTAAGCTGCCTGTGCGGCAGTTAAG | 4 |
![]() |
![]() |
2 | CRISPR | ACIAD | chromosome | 2371799 | 2373085 | 21 | CTTCACTACCGCACAGGTAGCTTAGAAA | 4 |
![]() |
![]() |
CAS-TypeIF_1 | CAS | ACIAD | chromosome | 2439177 | 2448017 | 5 | cas1_TypeIF, cas6_TypeIF, cas3-cas2_TypeIF, csy2_TypeIF, csy3_TypeIF | - |
![]() |
![]() |
3 | CRISPR | ACIAD | chromosome | 2448115 | 2453542 | 90 | GTTCGTCATCGCATAGATGATTTAGAAA | 4 |